pZYIntExc
(Plasmid
#139673)
-
PurposeExpression cassette for phiC31 Excisionase in T-DNA vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZY101
- Backbone size w/o insert (bp) 8838
- Total vector size (bp) 13817
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephiC31 Excisionase
-
Speciesbacteriophage p1
-
Insert Size (bp)2623
- Promoter Maize Ubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGCTCACCCTGTTGTTTGGTGT
- 3′ sequencing primer tttattgccaaatgtttgaacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZYIntExc was a gift from James Birchler (Addgene plasmid # 139673 ; http://n2t.net/addgene:139673 ; RRID:Addgene_139673) -
For your References section:
Site-specific recombinase genome engineering toolkit in maize. Cody JP, Graham ND, Zhao C, Swyers NC, Birchler JA. Plant Direct. 2020 Mar 9;4(3):e00209. doi: 10.1002/pld3.209. eCollection 2020 Mar. 10.1002/pld3.209 PubMed 32166212