pET30a-His6-ABP-LOXCATmut
(Plasmid
#139972)
-
PurposeA control for His6-ABP-LOXCAT where LOX is catalytically dead (mutations H265A and R268A)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 139972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET30a
- Backbone size w/o insert (bp) 8880
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameA fusion of lactate oxidase from A. viridans and catalase from E. coli
-
Alt nameHis6-ABP-LOXCATmut
-
SpeciesLactate oxidase from A. viridans and Catalase from E. coli
-
Insert Size (bp)3639
-
MutationMutation in H265A and R268A in LOX (used original numbering for LOX)
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TTGTGAGCGGATAACAATTCCCC
- 3′ sequencing primer AAGGGGTTATGCTAGTTATTGCTCAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthesized by Genscript Biotech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET30a-His6-ABP-LOXCATmut was a gift from Vamsi Mootha (Addgene plasmid # 139972 ; http://n2t.net/addgene:139972 ; RRID:Addgene_139972) -
For your References section:
An engineered enzyme that targets circulating lactate to alleviate intracellular NADH:NAD(+) imbalance. Patgiri A, Skinner OS, Miyazaki Y, Schleifer G, Marutani E, Shah H, Sharma R, Goodman RP, To TL, Robert Bao X, Ichinose F, Zapol WM, Mootha VK. Nat Biotechnol. 2020 Jan 13. pii: 10.1038/s41587-019-0377-7. doi: 10.1038/s41587-019-0377-7. 10.1038/s41587-019-0377-7 PubMed 31932725