pDECKO_mCherry_LINC02432
(Plasmid
#140107)
-
PurposeCRISPR-Cas9 library validation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDECKO_mCherry
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA1+scaffold+H1promoter+gRNA2
-
gRNA/shRNA sequence2 guide RNAs againsts lncRNA LINC02432
-
SpeciesH. sapiens (human)
- Promoter gRNA1 under U6 and gRNA2 under H1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTACAAAATACGTGACGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDECKO_mCherry_LINC02432 was a gift from Roderic Guigo (Addgene plasmid # 140107 ; http://n2t.net/addgene:140107 ; RRID:Addgene_140107) -
For your References section:
Paired guide RNA CRISPR-Cas9 screening for protein-coding genes and lncRNAs involved in transdifferentiation of human B-cells to macrophages. Arnan C, Ullrich S, Pulido-Quetglas C, Nurtdinov R, Esteban A, Blanco-Fernandez J, Aparicio-Prat E, Johnson R, Perez-Lluch S, Guigo R. BMC Genomics. 2022 May 26;23(1):402. doi: 10.1186/s12864-022-08612-7. 10.1186/s12864-022-08612-7 PubMed 35619054