pHIs8-4b-SaDAH::G226D
(Plasmid
#140130)
-
PurposeExpresses SaDAH::G226D variant with N-terminal 8xHis-tag in BL21 E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140130 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHis8-4b
- Backbone size w/o insert (bp) 5276
- Total vector size (bp) 6332
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDechloroacutumine halogenase G226D variant from Sinomenium acutum
-
Alt nameSaDAH::G226D
-
SpeciesSinomenium acutum
-
Insert Size (bp)1056
-
Mutationchanged Gly226 to Asp226
-
GenBank IDMT040708
- Promoter T7
-
Tag
/ Fusion Protein
- 8x-His, TEV protease site (ENLYFQ) (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expressed robustly in E.coli. Catalyzes hydroxylation of dechloroacutumine in vitro
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIs8-4b-SaDAH::G226D was a gift from Jing-Ke Weng (Addgene plasmid # 140130 ; http://n2t.net/addgene:140130 ; RRID:Addgene_140130) -
For your References section:
The chloroalkaloid (-)-acutumine is biosynthesized via a Fe(II)- and 2-oxoglutarate-dependent halogenase in Menispermaceae plants. Kim CY, Mitchell AJ, Glinkerman CM, Li FS, Pluskal T, Weng JK. Nat Commun. 2020 Apr 20;11(1):1867. doi: 10.1038/s41467-020-15777-w. 10.1038/s41467-020-15777-w PubMed 32313070