pCEFL GAL4dbd-KLF4 1-156
(Plasmid
#140147)
-
PurposeGAL4-DNA binding domain fusion protein with the 156 N-terminal amino acids of human KLF4 (activation domain)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140147 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCEFL
- Total vector size (bp) 6967
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKLF4 aa 1-156
-
SpeciesH. sapiens (human)
-
MutationDeleted amino acids 157 to 479
-
GenBank IDNM_004235
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
- Promoter EF1a
-
Tag
/ Fusion Protein
- GAL4dbd (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
- 3′ sequencing primer ATT TAG GTG ACA CTA TAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEFL GAL4dbd-KLF4 1-156 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 140147 ; http://n2t.net/addgene:140147 ; RRID:Addgene_140147) -
For your References section:
YAP1/TAZ-TEAD transcriptional networks maintain skin homeostasis by regulating cell proliferation and limiting KLF4 activity. Yuan Y, Park J, Feng A, Awasthi P, Wang Z, Chen Q, Iglesias-Bartolome R. Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0. 10.1038/s41467-020-15301-0 PubMed 32193376