Skip to main content

pCEFL GAL4dbd-KLF4 1-156
(Plasmid #140147)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140147 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 140147-D50 50 μg of DNA in Tris buffer $495
DNA 140147-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCEFL
  • Total vector size (bp) 6967
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KLF4 aa 1-156
  • Species
    H. sapiens (human)
  • Mutation
    Deleted amino acids 157 to 479
  • GenBank ID
    NM_004235
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Promoter EF1a
  • Tag / Fusion Protein
    • GAL4dbd (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
  • 3′ sequencing primer ATT TAG GTG ACA CTA TAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEFL GAL4dbd-KLF4 1-156 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 140147 ; http://n2t.net/addgene:140147 ; RRID:Addgene_140147)
  • For your References section:

    YAP1/TAZ-TEAD transcriptional networks maintain skin homeostasis by regulating cell proliferation and limiting KLF4 activity. Yuan Y, Park J, Feng A, Awasthi P, Wang Z, Chen Q, Iglesias-Bartolome R. Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0. 10.1038/s41467-020-15301-0 PubMed 32193376