pEU3-NII-GLICNot-C-BIOT
(Plasmid
#140186)
-
Purpose(Empty Backbone) Used for producing recombinant proteins by wheat germ-based cell-free translation, contains T7 promoter, GST-tag and biotinylation site, and NotI restriction site
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140186 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEU3-NII-GLICNot-C-BIOT
- Backbone size (bp) 4483
-
Vector typeexpression vector for a cell-free system
- Promoter T7
-
Tags
/ Fusion Proteins
- GST (N terminal on insert)
- Biotinylation (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTATAGGGTACACGGAATTCGC
- 3′ sequencing primer TATAGGAAGGCCGGATAAGACG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEU3-NII-GLICNot-C-BIOT was a gift from Tamás Mészáros (Addgene plasmid # 140186 ; http://n2t.net/addgene:140186 ; RRID:Addgene_140186) -
For your References section:
A novel family of expression vectors with multiple affinity tags for wheat germ cell-free protein expression. Nagy SK, Kallai BM, Andras J, Meszaros T. BMC Biotechnol. 2020 Mar 14;20(1):17. doi: 10.1186/s12896-020-00610-5. 10.1186/s12896-020-00610-5 PubMed 32169064