pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
(Plasmid
#140199)
-
PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYFAC-riboB
-
Backbone manufacturerDOI: 10.1039/C8SC02870B
- Backbone size w/o insert (bp) 14777
- Total vector size (bp) 25390
-
Vector typeCRISPR, Synthetic Biology ; Expression in Aspergillus nidulans and related filamentous fungi.
-
Selectable markersURA3 ; Af riboB
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedSpCas9-VPR
-
Alt namedCas9-VPR
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)5349
- Promoter PgpdA
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta), NLS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCAGTCCAACATTTGTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC was a gift from Yit Heng Chooi (Addgene plasmid # 140199 ; http://n2t.net/addgene:140199 ; RRID:Addgene_140199) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136