pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
(Plasmid
#140205)
-
PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKW20088
-
Backbone manufacturerdoi:10.1038/nchembio.1366
- Backbone size w/o insert (bp) 14245
- Total vector size (bp) 15879
-
Vector typeCRISPR, Synthetic Biology ; Proof-of-concept test target of a in filamentous fungi.
-
Selectable markersURA3 ; Af pyrG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemCherry
-
Insert Size (bp)709
-
MutationG174D
- Promoter PelcA
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CACTGAGAACCATGGCACCGAAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA E1
-
Insert Size (bp)96
- Promoter U3
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (destroyed during cloning)
- 3′ cloning site BsmbI (destroyed during cloning)
- 5′ sequencing primer ACAGAACAAACCGAGCAAACATG
- 3′ sequencing primer GCCAGTCACGATACATCCATGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To be cotransformed in strains expressing dSpCas9-VPR. This proof-of-concept vector is intended to serve as a positive control and aid the implementation of the CRISPRa vector set in other fungal species, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy when Cas9 is expressed from pCRI006. The mCherry mutation G174D does not appear to affect fluorescence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT was a gift from Yit Heng Chooi (Addgene plasmid # 140205 ; http://n2t.net/addgene:140205 ; RRID:Addgene_140205) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136