pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
(Plasmid #140205)

• Purpose: Proof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.
• Depositing Lab: Yit Heng Chooi
• Depositing Organization: University of Western Australia
  Located in Australia
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pKW20088
• Backbone manufacturer: doi:10.1038/nchembio.1366
• Backbone size w/o insert (bp): 14245
• Total vector size (bp): 15879
• Vector type: CRISPR, Synthetic Biology ; Proof-of-concept test target of a in filamentous fungi.
• Selectable markers: URA3 ; Af pyrG

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Insert Size (bp): 709
• Mutation: G174D
• Promoter: PelcA

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACTGAGAACCATGGCACCGAAG

Gene/Insert 2

• Gene/Insert name: sgRNA E1
• Insert Size (bp): 96
• Promoter: U3

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmbI (destroyed during cloning)
• 3′ cloning site: BsmbI (destroyed during cloning)
• 5′ sequencing primer: ACAGAACAAACCGAGCAAACATG
• 3′ sequencing primer: GCCAGTCACGATACATCCATGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To be cotransformed in strains expressing dSpCas9-VPR. This proof-of-concept vector is intended to serve as a positive control and aid the implementation of the CRISPRa vector set in other fungal species, facilitating initial testing and troubleshooting. The proof of concept activation is easily observable in Aspergillus nidulans with fluorescence microscopy when Cas9 is expressed from pCRI006. The mCherry mutation G174D does not appear to affect fluorescence.

DNA (Catalog # 140205-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 140205-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.