pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC
(Plasmid
#140200)
-
Purpose(Empty Backbone) Cloning vector for LbCas12a crRNAs ( Step 1 of the 2-step cloning alternative). Full PgpdA sequence is reconstituted when amplifying the expression cassette for cloning in a fungal vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGemT
-
Backbone manufacturerPromega
- Backbone size (bp) 3003
-
Vector typeCRISPR, Synthetic Biology
- Promoter PgpdA
-
Tags
/ Fusion Proteins
- dLbCas12a crRNA scaffold (N terminal on insert)
- dLbCas12a crRNA scaffold (C terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GTCAGTCCAACATTTGTTGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
First step of the 2-vector crRNA array cloning alternative. Cloning of crRNA arrays is done with BsmbI digestion of the vector and ligation of annealed oligonucleotides containing the crRNA sequences, making use of the two crRNA scaffolds in the vector to start and finish the array. Screening can be performed with EcoRI digestion. The expression cassette is further PCR amplified with primers that contain the 10 bp missing in the 5' of this vector Pgpda. This amplicon is then cloned in a fungal vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI007-pGEM-PgpdA-Cas12aScaffold-BsmbI-TtrpC was a gift from Yit Heng Chooi (Addgene plasmid # 140200 ; http://n2t.net/addgene:140200 ; RRID:Addgene_140200) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136