TP2_crtYB
              
              
                (Plasmid
                
                #140233)
              
            
            
            
          - 
            PurposeExpression of gene coding lycopene bifunctional β-cyclase for production beta-carotene from lycopene
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backboneTPS2
- Total vector size (bp) 6224
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namephytoene-beta carotene synthase
- 
                  Alt namecrtYB
- 
                  Insert Size (bp)2016
- 
                  Mutationna
- 
                    GenBank IDAII26676.1
- Promoter t7 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggatctcgacgctctccctt
- 3′ sequencing primer CCcaagtgtgagtcgagggAA (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The minor differences between the sequence and .gb file are of no functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: TP2_crtYB was a gift from Kang Zhou (Addgene plasmid # 140233 ; http://n2t.net/addgene:140233 ; RRID:Addgene_140233)
 
    
 
                         
             
            