pmCherry-U6-EMX1
(Plasmid
#140581)
-
PurposeExpresses a gRNA and mCherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmCherry-U6
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA EMX1
-
gRNA/shRNA sequenceGAGTCCGAGCAGAAGAAGAA
-
SpeciesSynthetic
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-U6-EMX1 was a gift from Feng Zhang (Addgene plasmid # 140581 ; http://n2t.net/addgene:140581 ; RRID:Addgene_140581) -
For your References section:
Highly Parallel Profiling of Cas9 Variant Specificity. Schmid-Burgk JL, Gao L, Li D, Gardner Z, Strecker J, Lash B, Zhang F. Mol Cell. 2020 Mar 17. pii: S1097-2765(20)30143-X. doi: 10.1016/j.molcel.2020.02.023. 10.1016/j.molcel.2020.02.023 PubMed 32187529