Skip to main content

pmCherry-U6-EMX1
(Plasmid #140581)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140581 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-U6
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA EMX1
  • gRNA/shRNA sequence
    GAGTCCGAGCAGAAGAAGAA
  • Species
    Synthetic

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-U6-EMX1 was a gift from Feng Zhang (Addgene plasmid # 140581 ; http://n2t.net/addgene:140581 ; RRID:Addgene_140581)
  • For your References section:

    Highly Parallel Profiling of Cas9 Variant Specificity. Schmid-Burgk JL, Gao L, Li D, Gardner Z, Strecker J, Lash B, Zhang F. Mol Cell. 2020 Mar 17. pii: S1097-2765(20)30143-X. doi: 10.1016/j.molcel.2020.02.023. 10.1016/j.molcel.2020.02.023 PubMed 32187529