Skip to main content
Addgene

pQCascade-tra13
(Plasmid #140628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140628 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDFDuet-1
  • Vector type
    Bacterial Expression, CRISPR ; Transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VchTniQ, VchCas8, VchCas7, VchCas6, crRNA-tra13
  • gRNA/shRNA sequence
    tgaaaatgcagaggccttcggcaaagcatcta
  • Species
    Vibrio cholera

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

An unexpected 65 bp insertion was detected in the origin of replication, comparing to the sequence of the backbone plasmid pCDFDuet-1. But, the plasmid has been proven to work normally.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCascade-tra13 was a gift from Sheng Yang (Addgene plasmid # 140628 ; http://n2t.net/addgene:140628 ; RRID:Addgene_140628)
  • For your References section:

    Multicopy chromosomal integration using CRISPR-associated transposases. Zhang Y, Sun X, Wang Q, Xu J, Dong F, Yang S, Yang J, Zhang Z, Qian Y, Chen J, Zhang J, Liu Y, Tao R, Jiang Y, Yang J, Yang S. ACS Synth Biol. 2020 Jun 17. doi: 10.1021/acssynbio.0c00073. 10.1021/acssynbio.0c00073 PubMed 32551502