Skip to main content

pPB-TRE-ECC-Biosensor
(Plasmid #140833)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140833 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPB
  • Backbone size w/o insert (bp) 6825
  • Total vector size (bp) 10198
  • Modifications to backbone
    no
  • Vector type
    Mammalian Expression ; PiggyBac (PB) transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRE-ECC Biosensor
  • Species
    Synthetic
  • Insert Size (bp)
    3373
  • Promoter inverse

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CTTCCTACCCTCGTAAAGGTC
  • 3′ sequencing primer TCGCAGATCCACTTAGATTCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence differs from the depositor's reference sequence but does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-TRE-ECC-Biosensor was a gift from Yonglun Luo (Addgene plasmid # 140833 ; http://n2t.net/addgene:140833 ; RRID:Addgene_140833)
  • For your References section:

    CRISPR-C: circularization of genes and chromosome by CRISPR in human cells. Moller HD, Lin L, Xiang X, Petersen TS, Huang J, Yang L, Kjeldsen E, Jensen UB, Zhang X, Liu X, Xu X, Wang J, Yang H, Church GM, Bolund L, Regenberg B, Luo Y. Nucleic Acids Res. 2018 Dec 14;46(22):e131. doi: 10.1093/nar/gky767. 10.1093/nar/gky767 PubMed 30551175