pPB-TRE-ECC-Biosensor
(Plasmid
#140833)
-
PurposeEncoding the TRE promoter based eccDNA biosensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140833 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPB
- Backbone size w/o insert (bp) 6825
- Total vector size (bp) 10198
-
Modifications to backboneno
-
Vector typeMammalian Expression ; PiggyBac (PB) transposon
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE-ECC Biosensor
-
SpeciesSynthetic
-
Insert Size (bp)3373
- Promoter inverse
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CTTCCTACCCTCGTAAAGGTC
- 3′ sequencing primer TCGCAGATCCACTTAGATTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence differs from the depositor's reference sequence but does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-TRE-ECC-Biosensor was a gift from Yonglun Luo (Addgene plasmid # 140833 ; http://n2t.net/addgene:140833 ; RRID:Addgene_140833) -
For your References section:
CRISPR-C: circularization of genes and chromosome by CRISPR in human cells. Moller HD, Lin L, Xiang X, Petersen TS, Huang J, Yang L, Kjeldsen E, Jensen UB, Zhang X, Liu X, Xu X, Wang J, Yang H, Church GM, Bolund L, Regenberg B, Luo Y. Nucleic Acids Res. 2018 Dec 14;46(22):e131. doi: 10.1093/nar/gky767. 10.1093/nar/gky767 PubMed 30551175