Skip to main content

pSC101-pT7-T3RNAP
(Plasmid #140872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140872 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC101
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6437
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    T3 RNA polymerase
  • Alt name
    T3 RNAP
  • Species
    phage T3
  • Insert Size (bp)
    2700
  • Promoter T7 promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgaggatcttaaggctagag
  • 3′ sequencing primer ctgcaggaattcgatatcaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC101-pT7-T3RNAP was a gift from Neal Devaraj (Addgene plasmid # 140872 ; http://n2t.net/addgene:140872 ; RRID:Addgene_140872)
  • For your References section:

    Communication and quorum sensing in non-living mimics of eukaryotic cells. Niederholtmeyer H, Chaggan C, Devaraj NK. Nat Commun. 2018 Nov 28;9(1):5027. doi: 10.1038/s41467-018-07473-7. 10.1038/s41467-018-07473-7 PubMed 30487584