pcDNA5/FRT/TO-GAlphasL-RLuc8
(Plasmid
#140981)
-
PurposeEncodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140981 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5203
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAlphasL-RLuc8
-
Alt nameGNAS1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2154
-
MutationRLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 137 of the alpha subunit
-
Entrez GeneGNAS (a.k.a. AHO, C20orf45, GNAS1, GPSA, GSA, GSP, NESP, PITA3, POH, SCG6, SgVI)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO-GAlphasL-RLuc8 was a gift from Bryan Roth (Addgene plasmid # 140981 ; http://n2t.net/addgene:140981 ; RRID:Addgene_140981) -
For your References section:
TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019