pcDNA5/FRT/TO-GAlphasL-RLuc8
(Plasmid #140981)

• Purpose: Encodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociation
• Depositing Lab: Bryan Roth
• Publication: Olsen et al Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8.

Backbone

• Vector backbone: pcDNA5/FRT/TO
  (Search Vector Database)
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5203
• Vector type: Mammalian Expression, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GAlphasL-RLuc8
• Alt name: GNAS1
• Species: H. sapiens (human)
• Insert Size (bp): 2154
• Mutation: RLuc8 and flanking SGGGGS linkers have been inserted at amino acid position 137 of the alpha subunit
• Entrez Gene: GNAS (a.k.a. AHO, C20orf45, GNAS1, GPSA, GSA, GSP, NESP, PITA3, POH, SCG6, SgVI)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry