Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #140991)


Item Catalog # Description Quantity Price (USD)
Plasmid 140991 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5432
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    GNGT2 (a.k.a. G-GAMMA-8, G-GAMMA-C, GNG9, GNGT8)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP2 and GSAG linker (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-GGamma9-GFP2 was a gift from Bryan Roth (Addgene plasmid # 140991 ; ; RRID:Addgene_140991)
  • For your References section:

    TRUPATH, an open-source biosensor platform for interrogating the GPCR transducerome. Olsen RHJ, DiBerto JF, English JG, Glaudin AM, Krumm BE, Slocum ST, Che T, Gavin AC, McCorvy JD, Roth BL, Strachan RT. Nat Chem Biol. 2020 May 4. pii: 10.1038/s41589-020-0535-8. doi: 10.1038/s41589-020-0535-8. 10.1038/s41589-020-0535-8 PubMed 32367019