Skip to main content
Holiday Schedule: Addgene will be closed November 24th & 25th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #141084)


Item Catalog # Description Quantity Price (USD)
Plasmid 141084 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 5386
  • Modifications to backbone
    No modifications
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer EF1 Forward (CTCCACGCTTTGCCTGACCCTGCTT)
  • 3′ sequencing primer T2A Reverse (CGTCACCGCATGTTAGAAGACTTCCTCTGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SEPLuc-E2A-cyOFP1 was a gift from Jeak Ling Ding (Addgene plasmid # 141084 ; ; RRID:Addgene_141084)
  • For your References section:

    pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886