Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Antares-SEPLuc IRESv24
(Plasmid #141087)


Item Catalog # Description Quantity Price (USD)
Plasmid 141087 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4606
  • Total vector size (bp) 9169
  • Modifications to backbone
    Neomycin deleted
  • Vector type
    Mammalian Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 forward (TTAATACGACTCACTATAGGG)
  • 3′ sequencing primer BGH reverse (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Antares-SEPLuc IRESv24 was a gift from Jeak Ling Ding (Addgene plasmid # 141087 ; ; RRID:Addgene_141087)
  • For your References section:

    pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886