pUAP1_Ta_Yr7_CDS_no_STOP
(Plasmid
#141093)
-
PurposeLevel 0 Golden gate module with the coding sequence of Cadenza-Yr7 without its STOP codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUAP1 (Addgene #63674)
- Backbone size w/o insert (bp) 3138
- Total vector size (bp) 6815
-
Vector typeUnspecified ; Level 0 module for Golden Gate cloning (AATG - TTCG overhangs)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTa_Yr7
-
SpeciesTriticum aestivum cv. Cadenza
-
Insert Size (bp)4758
-
GenBank IDMN273771.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (unknown if destroyed)
- 3′ cloning site BpiI (unknown if destroyed)
- 5′ sequencing primer AAGTTGGAACCTCTTACGTGC
- 3′ sequencing primer AACCGTATTACCGCCTTTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUAP1_Ta_Yr7_CDS_no_STOP was a gift from Cristobal Uauy (Addgene plasmid # 141093 ; http://n2t.net/addgene:141093 ; RRID:Addgene_141093) -
For your References section:
Comparative Genomics and Functional Studies of Wheat BED-NLR Loci. Marchal C, Wheat Genome Project, Haberer G, Spannagl M, Uauy C. Genes (Basel). 2020 Nov 26;11(12). pii: genes11121406. doi: 10.3390/genes11121406. 10.3390/genes11121406 PubMed 33256067