Skip to main content

pUAP1_Ta_Yr7_CDS_no_STOP
(Plasmid #141093)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141093 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUAP1 (Addgene #63674)
  • Backbone size w/o insert (bp) 3138
  • Total vector size (bp) 6815
  • Vector type
    Unspecified ; Level 0 module for Golden Gate cloning (AATG - TTCG overhangs)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ta_Yr7
  • Species
    Triticum aestivum cv. Cadenza
  • Insert Size (bp)
    4758
  • GenBank ID
    MN273771.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (unknown if destroyed)
  • 3′ cloning site BpiI (unknown if destroyed)
  • 5′ sequencing primer AAGTTGGAACCTCTTACGTGC
  • 3′ sequencing primer AACCGTATTACCGCCTTTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUAP1_Ta_Yr7_CDS_no_STOP was a gift from Cristobal Uauy (Addgene plasmid # 141093 ; http://n2t.net/addgene:141093 ; RRID:Addgene_141093)
  • For your References section:

    Comparative Genomics and Functional Studies of Wheat BED-NLR Loci. Marchal C, Wheat Genome Project, Haberer G, Spannagl M, Uauy C. Genes (Basel). 2020 Nov 26;11(12). pii: genes11121406. doi: 10.3390/genes11121406. 10.3390/genes11121406 PubMed 33256067