SEPLuc
(Plasmid
#141102)
-
Purposebioluminescent reporter consisting of a membrane-bound SEP and Nanoluc fusion; for monitoring extracellular tumor acidosis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141102 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-EF1-MCS-T2A-Puro
-
Backbone manufacturerSystem Biosciences (SBI)
- Backbone size w/o insert (bp) 7068
- Total vector size (bp) 8502
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSEP-Nanoluc
-
Alt nameSEPLuc
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)1434
- Promoter EF1α
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EF1 Forward (CTCCACGCTTTGCCTGACCCTGCTT)
- 3′ sequencing primer T2A Reverse (CGTCACCGCATGTTAGAAGACTTCCTCTGC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SEPLuc was a gift from Jeak Ling Ding (Addgene plasmid # 141102 ; http://n2t.net/addgene:141102 ; RRID:Addgene_141102) -
For your References section:
pHLuc, a Ratiometric Luminescent Reporter for in vivo Monitoring of Tumor Acidosis. Ong TT, Ang Z, Verma R, Koean R, Tam JKC, Ding JL. Front Bioeng Biotechnol. 2020 May 8;8:412. doi: 10.3389/fbioe.2020.00412. eCollection 2020. 10.3389/fbioe.2020.00412 PubMed 32457886