Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIAA5::LUC
(Plasmid #141169)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141169 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJS
  • Backbone manufacturer
    Jen Sheen, ABRC FRK1-LUC / CD3-919
  • Backbone size w/o insert (bp) 4732
  • Total vector size (bp) 5654
  • Vector type
    Plant Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AtIAA5 promoter
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    922
  • GenBank ID
    At1g15580
  • Promoter AtIAA5, At1g15580

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTTCCCAGTCACGAC
  • 3′ sequencing primer CTTATGCAGTTGCTCTCCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    We received the plasmid backbone by BamHI/NcoI restriction digest from FRK1-LUC (ABRC CD3-919, donated by Jen Sheen) and used it to insert the promoters by Gibson cloning.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIAA5::LUC was a gift from Vardis Ntoukakis & Patrick Schäfer (Addgene plasmid # 141169 ; http://n2t.net/addgene:141169 ; RRID:Addgene_141169)
  • For your References section:

    Novel markers for high-throughput protoplast-based analyses of phytohormone signaling. Lehmann S, Dominguez-Ferreras A, Huang WJ, Denby K, Ntoukakis V, Schafer P. PLoS One. 2020 Jun 4;15(6):e0234154. doi: 10.1371/journal.pone.0234154. eCollection 2020. 10.1371/journal.pone.0234154 PubMed 32497144