Skip to main content

pARR5::LUC
(Plasmid #141170)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141170 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJS
  • Backbone manufacturer
    Jen Sheen, ABRC FRK1-LUC / CD3-919
  • Backbone size w/o insert (bp) 4732
  • Total vector size (bp) 6381
  • Vector type
    Plant Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AtARR5 promoter
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1649
  • GenBank ID
    AT3G48100
  • Promoter AtARR5, AT3G48100

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTTTCCCAGTCACGAC
  • 3′ sequencing primer CTTATGCAGTTGCTCTCCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    We received the plasmid backbone by BamHI/NcoI restriction digest from FRK1-LUC (ABRC CD3-919, donated by Jen Sheen) and used it to insert the promoters by Gibson cloning.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

An extra T nucleotide was identified by both Sanger and Illumina NGS in the ARR5 compared to the genomic reference. Both sequencing technologies are prone to generating artifacts in the determination of long mononucleotide stretches and the difference, if not an artifact, is not known to impact the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pARR5::LUC was a gift from Vardis Ntoukakis & Patrick Schäfer (Addgene plasmid # 141170 ; http://n2t.net/addgene:141170 ; RRID:Addgene_141170)
  • For your References section:

    Novel markers for high-throughput protoplast-based analyses of phytohormone signaling. Lehmann S, Dominguez-Ferreras A, Huang WJ, Denby K, Ntoukakis V, Schafer P. PLoS One. 2020 Jun 4;15(6):e0234154. doi: 10.1371/journal.pone.0234154. eCollection 2020. 10.1371/journal.pone.0234154 PubMed 32497144