Skip to main content

pOT2-poly-cis
(Plasmid #141177)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141177 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOT2
  • Backbone size (bp) 3700
  • Modifications to backbone
    Adding poly-Cis
  • Vector type
    Plant Expression, RNAi, Synthetic Biology
  • Promoter CaMV 35S promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer catttggagaggacagcccaag
  • 3′ sequencing primer ctggtgatttcagcgtaccgaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOT2-poly-cis was a gift from Guiliang Tang (Addgene plasmid # 141177 ; http://n2t.net/addgene:141177 ; RRID:Addgene_141177)