pOT2-poly-cis
(Plasmid
#141177)
-
Purpose(Empty Backbone) To clone any gene or STTM sequence or artificial miRNA under CaMV 35S promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141177 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepOT2
- Backbone size (bp) 3700
-
Modifications to backboneAdding poly-Cis
-
Vector typePlant Expression, RNAi, Synthetic Biology
- Promoter CaMV 35S promoter
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer catttggagaggacagcccaag
- 3′ sequencing primer ctggtgatttcagcgtaccgaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOT2-poly-cis was a gift from Guiliang Tang (Addgene plasmid # 141177 ; http://n2t.net/addgene:141177 ; RRID:Addgene_141177)