Skip to main content

pGWB601NL3F10H
(Plasmid #141287)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141287 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGWB601
  • Backbone manufacturer
    Tsuyoshi Nakagawa
  • Backbone size (bp) 10700
  • Modifications to backbone
    We created a series of vectors using the NL3F10H reporter instead of LUC+. This was achieved by amplifying a sub-fragment of the Gateway cassette and fusing it with NL3F10H and pGWB401 digested with NcoI/SacI by Gibson assembly.
  • Vector type
    Plant Expression, Luciferase ; Gateway
  • Selectable markers
    Basta
  • Tags / Fusion Proteins
    • NLUC (C terminal on backbone)
    • FLAG (x3) (C terminal on backbone)
    • HIS (x10) (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTAAAACGACGGCCAGTGC
  • 3′ sequencing primer CCGCTCAGGACAATCCTTTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation (UK, Delta House, Southampton Science Park, Southampton, SO16 7NS) and propagated in E. coli DH5alpha (Invitrogen, ThermoFisher Scientific, Waltham, Massachusetts, US). The NanoLUC sequence was amplified, and cloned via a pET28a(+) (Novagen, Merck, Darmstadt, Germany) intermediate vector into a pUC19 vector carrying a 3× FLAG 10× His peptide as a C-terminal translational fusion, to form NanoLUC-3× FLAG-10× His (NL3F10H). The 3× FLAG-10His was chemically synthesised by Eurogentec (Seraing, Belgium).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGWB601NL3F10H was a gift from Andrew Millar (Addgene plasmid # 141287 ; http://n2t.net/addgene:141287 ; RRID:Addgene_141287)
  • For your References section:

    Expanding the bioluminescent reporter toolkit for plant science with NanoLUC. Urquiza-Garcia U, Millar AJ. Plant Methods. 2019 Jul 8;15:68. doi: 10.1186/s13007-019-0454-4. eCollection 2019. 10.1186/s13007-019-0454-4 PubMed 31316580