Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGWB701NL3F10H
(Plasmid #141288)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141288 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGWB701
  • Backbone manufacturer
    Tsuyoshi Nakagawa
  • Backbone size (bp) 11322
  • Modifications to backbone
    We created a series of vectors using the NL3F10H reporter instead of LUC+. This was achieved by amplifying a sub-fragment of the Gateway cassette and fusing it with NL3F10H and pGWB401 digested with NcoI/SacI by Gibson assembly.
  • Vector type
    Plant Expression, Luciferase ; Gateway
  • Selectable markers
    Tunicamycin
  • Tags / Fusion Proteins
    • NLUC (C terminal on backbone)
    • FLAG (x3) (C terminal on backbone)
    • HIS (x10) (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TGTAAAACGACGGCCAGTGC
  • 3′ sequencing primer CCGCTCAGGACAATCCTTTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation (UK, Delta House, Southampton Science Park, Southampton, SO16 7NS) and propagated in E. coli DH5alpha (Invitrogen, ThermoFisher Scientific, Waltham, Massachusetts, US). The NanoLUC sequence was amplified, and cloned via a pET28a(+) (Novagen, Merck, Darmstadt, Germany) intermediate vector into a pUC19 vector carrying a 3× FLAG 10× His peptide as a C-terminal translational fusion, to form NanoLUC-3× FLAG-10× His (NL3F10H). The 3× FLAG-10His was chemically synthesised by Eurogentec (Seraing, Belgium).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGWB701NL3F10H was a gift from Andrew Millar (Addgene plasmid # 141288 ; http://n2t.net/addgene:141288 ; RRID:Addgene_141288)
  • For your References section:

    Expanding the bioluminescent reporter toolkit for plant science with NanoLUC. Urquiza-Garcia U, Millar AJ. Plant Methods. 2019 Jul 8;15:68. doi: 10.1186/s13007-019-0454-4. eCollection 2019. 10.1186/s13007-019-0454-4 PubMed 31316580