Skip to main content

pMP71-Kaede
(Plasmid #141352)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 141352 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMP71
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 5200
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kaede
  • Species
    Synthetic
  • Insert Size (bp)
    678
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GCTCCACAAAGTTAAGTAATAGTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMP71-Kaede was a gift from Ton Schumacher (Addgene plasmid # 141352 ; http://n2t.net/addgene:141352 ; RRID:Addgene_141352)
  • For your References section:

    A mouse model that is immunologically tolerant to reporter and modifier proteins. Bresser K, Dijkgraaf FE, Pritchard CEJ, Huijbers IJ, Song JY, Rohr JC, Scheeren FA, Schumacher TN. Commun Biol. 2020 May 29;3(1):273. doi: 10.1038/s42003-020-0979-0. 10.1038/s42003-020-0979-0 PubMed 32472011