Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

TFORF2555
(Plasmid #144130)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 144130 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLX_TRC317
  • Backbone manufacturer
    Broad Institute Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 8264
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SUZ12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2252
  • Entrez Gene
    SUZ12 (a.k.a. CHET9, IMMAS, JJAZ1)
  • Promoter EF1a

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GGGTGGAGACTGAAGTTAGGCCAG
  • 3′ sequencing primer CACATAGCGTAAAAGGAGCAACATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NM_001321207,ENST00000580398 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at [email protected] prior to placing an order to request the full sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TFORF2555 was a gift from Feng Zhang (Addgene plasmid # 144130 ; http://n2t.net/addgene:144130 ; RRID:Addgene_144130)
  • For your References section:

    A transcription factor atlas of directed differentiation. Joung J, Ma S, Tay T, Geiger-Schuller KR, Kirchgatterer PC, Verdine VK, Guo B, Arias-Garcia MA, Allen WE, Singh A, Kuksenko O, Abudayyeh OO, Gootenberg JS, Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell. 2023 Jan 5;186(1):209-229.e26. doi: 10.1016/j.cell.2022.11.026. 10.1016/j.cell.2022.11.026 PubMed 36608654