pJT303_SNR52_sgRNA_Can1-3
(Plasmid
#145066)
-
PurposeExpresses sgRNA targeting Can1-3 site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep426
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6200
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCan1-3 sgRNA
-
Alt nameCAN1
-
gRNA/shRNA sequenceACGTCCAAAATTGAATGACT
-
SpeciesS. cerevisiae (budding yeast)
- Promoter SNR52
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer T3 promoter
- 3′ sequencing primer T7 promoter (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe gRNA expression cassette is based on p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803) from the Church lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJT303_SNR52_sgRNA_Can1-3 was a gift from Ralph Bock (Addgene plasmid # 145066 ; http://n2t.net/addgene:145066 ; RRID:Addgene_145066) -
For your References section:
Engineering of high-precision base editors for site-specific single nucleotide replacement. Tan J, Zhang F, Karcher D, Bock R. Nat Commun. 2019 Jan 25;10(1):439. doi: 10.1038/s41467-018-08034-8. 10.1038/s41467-018-08034-8 PubMed 30683865