Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJT303_SNR52_sgRNA_Can1-3
(Plasmid #145066)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 145066 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p426
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6200
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Can1-3 sgRNA
  • Alt name
    CAN1
  • gRNA/shRNA sequence
    ACGTCCAAAATTGAATGACT
  • Species
    S. cerevisiae (budding yeast)
  • Promoter SNR52

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gRNA expression cassette is based on p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803) from the Church lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJT303_SNR52_sgRNA_Can1-3 was a gift from Ralph Bock (Addgene plasmid # 145066 ; http://n2t.net/addgene:145066 ; RRID:Addgene_145066)
  • For your References section:

    Engineering of high-precision base editors for site-specific single nucleotide replacement. Tan J, Zhang F, Karcher D, Bock R. Nat Commun. 2019 Jan 25;10(1):439. doi: 10.1038/s41467-018-08034-8. 10.1038/s41467-018-08034-8 PubMed 30683865