Skip to main content
Addgene

pGAL4-DBD-MNX1wt-IDR
(Plasmid #145248)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145248 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MNX1wt-IDR
  • Species
    H. sapiens (human)
  • Entrez Gene
    MNX1 (a.k.a. HB9, HLXB9, HOXHB9, SCRA1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer agactgatatgcctctaaca
  • 3′ sequencing primer GAGAAAGGAAGGGAAGAAAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGAL4-DBD-MNX1wt-IDR was a gift from Denes Hnisz (Addgene plasmid # 145248 ; http://n2t.net/addgene:145248 ; RRID:Addgene_145248)
  • For your References section:

    Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Basu S, Mackowiak SD, Niskanen H, Knezevic D, Asimi V, Grosswendt S, Geertsema H, Ali S, Jerkovic I, Ewers H, Mundlos S, Meissner A, Ibrahim DM, Hnisz D. Cell. 2020 May 28;181(5):1062-1079.e30. doi: 10.1016/j.cell.2020.04.018. Epub 2020 May 7. 10.1016/j.cell.2020.04.018 PubMed 32386547