pCFP-LacI-HOXD13(+7A)-IDR
(Plasmid
#145256)
-
PurposeExpresses fusion of ECFP-LacI and HOXD13+7A IDR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEYFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHOXD13(+7A)-IDR
-
SpeciesH. sapiens (human)
-
MutationA-repeat expanded
-
Entrez GeneHOXD13 (a.k.a. BDE, BDSD, HOX4I, SPD, SPD1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CAATACGCAAACCGCCTCTC
- 3′ sequencing primer ttgatgagtttggacaaaccac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFP-LacI-HOXD13(+7A)-IDR was a gift from Denes Hnisz (Addgene plasmid # 145256 ; http://n2t.net/addgene:145256 ; RRID:Addgene_145256) -
For your References section:
Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Basu S, Mackowiak SD, Niskanen H, Knezevic D, Asimi V, Grosswendt S, Geertsema H, Ali S, Jerkovic I, Ewers H, Mundlos S, Meissner A, Ibrahim DM, Hnisz D. Cell. 2020 May 28;181(5):1062-1079.e30. doi: 10.1016/j.cell.2020.04.018. Epub 2020 May 7. 10.1016/j.cell.2020.04.018 PubMed 32386547