RCASBP(A)-3xFlag-mHoxd13+7Ala
(Plasmid
#145289)
-
PurposeAvian Expression of murine SPDH (+7Ala) Hoxd13 with N-terminal 3xFlag tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145289 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneRCASBP(A)
-
Vector typeViral Avian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHoxd13(+7Ala)
-
Alt nameHoxd13(spdh)
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1169
-
MutationA-repeat expanded
-
Entrez GeneHoxd13 (a.k.a. Hox-4.8, spdh)
-
Tag
/ Fusion Protein
- 3xFlag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site SpeI (unknown if destroyed)
- 5′ sequencing primer gagctgagctgactctgctggtgg
- 3′ sequencing primer tcaggagacagtgtctttgagcttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCASBP(A)-3xFlag-mHoxd13+7Ala was a gift from Denes Hnisz (Addgene plasmid # 145289 ; http://n2t.net/addgene:145289 ; RRID:Addgene_145289) -
For your References section:
Unblending of Transcriptional Condensates in Human Repeat Expansion Disease. Basu S, Mackowiak SD, Niskanen H, Knezevic D, Asimi V, Grosswendt S, Geertsema H, Ali S, Jerkovic I, Ewers H, Mundlos S, Meissner A, Ibrahim DM, Hnisz D. Cell. 2020 May 28;181(5):1062-1079.e30. doi: 10.1016/j.cell.2020.04.018. Epub 2020 May 7. 10.1016/j.cell.2020.04.018 PubMed 32386547