pET28b-6His-AcpS
(Plasmid
#145376)
-
PurposeExpression of E. coli AcpS
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145376 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepET28b
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAcpS
-
SpeciesE. coli
-
Insert Size (bp)381
-
Entrez GeneacpP (a.k.a. b1094, ECK1080)
-
Tag
/ Fusion Protein
- 6-His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28b-6His-AcpS was a gift from Robert Tomko (Addgene plasmid # 145376 ; http://n2t.net/addgene:145376 ; RRID:Addgene_145376) -
For your References section:
A suite of PCR-based peptide tagging plasmids to permit epitope-targeted enzymatic functionalization of yeast proteins. Nemec AA, Tomko RJ Jr. Yeast. 2020 May 13. doi: 10.1002/yea.3471. 10.1002/yea.3471 PubMed 32401365