SG3ΔENV CA Q63A,Q67A
(Plasmid
#145784)
-
PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q63A,Q67A mutation in capsid (CA Q63A,Q67A).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTZ19U
-
Backbone manufacturerBio-Rad
- Backbone size w/o insert (bp) 2863
- Total vector size (bp) 14788
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Lentiviral, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsRecombination deficient strain required to avoid recombination of plasmid
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCapsid
-
Alt nameCA
-
SpeciesHIV-1
-
MutationChanged Capsid residues Glutamines 63 and 67 to alanines (CA Q63A,Q67A)
-
GenBank IDL02317.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BssHII (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GCTTGCTGAAGCGCGCAC
- 3′ sequencing primer GAAGGGTACTAGTAGTTCCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloned from NIH Aids reagent program plasmid SG3delENV catalog #11051
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SG3ΔENV CA Q63A,Q67A was a gift from Wesley Sundquist (Addgene plasmid # 145784 ; http://n2t.net/addgene:145784 ; RRID:Addgene_145784) -
For your References section:
Reconstitution and visualization of HIV-1 capsid-dependent replication and integration in vitro. Christensen DE, Ganser-Pornillos BK, Johnson JS, Pornillos O, Sundquist WI. Science. 2020 Oct 9;370(6513). pii: 370/6513/eabc8420. doi: 10.1126/science.abc8420. 10.1126/science.abc8420 PubMed 33033190