-
PurposeBacterial expression of EBFP2 blue fluorescent protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 14891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 | ||
Cloning Grade DNA | 14891-DNA.cg | 2 µg of cloning grade DNA in Tris buffer | 1 | $95 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBad/His B
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4100
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEBFP2
-
Alt nameEBFP2 blue fluorescent protein
-
Speciesevolved fluorescent protein
-
Insert Size (bp)720
-
MutationThe fluorescent protein was inserted between XhoI and EcoR1 of pBad/His B. There is an extra 'C' after XhoI to avoid the frameshift.
-
GenBank IDEF517318
-
Tag
/ Fusion Protein
- His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Information for Cloning Grade DNA (Catalog # 14891-DNA.cg) ( Back to top )
Purpose
Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.
Delivery
- Amount 2 µg
- Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
- Pricing $95 USD
- Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Quality Control
Addgene has verified this plasmid using Next Generation Sequencing. Results are available here
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBad-EBFP2 was a gift from Robert Campbell (Addgene plasmid # 14891 ; http://n2t.net/addgene:14891 ; RRID:Addgene_14891) -
For your References section:
Exploration of New Chromophore Structures Leads to the Identification of Improved Blue Fluorescent Proteins. Ai HW, Shaner NC, Cheng Z, Tsien RY, Campbell RE. Biochemistry. 2007 Apr 20. ():. 10.1021/bi700199g PubMed 17444659