Skip to main content

pDONR207 SARS-CoV-2 NSP3_nostop
(Plasmid #149306)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149306 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pDONR207
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5585
  • Vector type
    Gateway-compatible Entry vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NSP3
  • Alt name
    PLPRO
  • Species
    SARS-CoV-2 isolate Wuhan-Hu-1
  • Insert Size (bp)
    5838
  • Mutation
    Many synonymous changes due to codon optimization
  • Entrez Gene
    ORF1ab (a.k.a. GU280_gp01)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGATCT
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthesized from GenScript
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONR207 SARS-CoV-2 NSP3_nostop was a gift from Fritz Roth (Addgene plasmid # 149306 ; http://n2t.net/addgene:149306 ; RRID:Addgene_149306)
  • For your References section:

    A Comprehensive, Flexible Collection of SARS-CoV-2 Coding Regions. Kim DK, Knapp JJ, Kuang D, Chawla A, Cassonnet P, Lee H, Sheykhkarimli D, Samavarchi-Tehrani P, Abdouni H, Rayhan A, Li R, Pogoutse O, Coyaud E, van der Werf S, Demeret C, Gingras AC, Taipale M, Raught B, Jacob Y, Roth FP. G3 (Bethesda). 2020 Aug 6. pii: g3.120.401554. doi: 10.1534/g3.120.401554. 10.1534/g3.120.401554 PubMed 32763951