pDOC-GG
(Plasmid
#149377)
-
PurposeChassis plasmid for building mutagenesis cassettes by Golden Gate assembly to form a donor plasmid for recombineering by Gene Doctoring
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDOC-K
- Backbone size w/o insert (bp) 3378
- Total vector size (bp) 5960
-
Modifications to backboneVector backbone fragment containing sacB gene generated by PCR with forward primer GGTAGTGTGGCGAGAGTAGGGAACTGCCAG and reverse primer CCAATTCTGACACATTTCCCCGAAAAGTGCC
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFragment containing a kanamycin resistance cassette
-
Alt namekanR
-
Alt nameaph(3')-Ia
-
Alt nameneoR
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)968
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer none (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFragment containing pMB1 origin of replication and an I-SceI recognition sequence
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)933
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer none (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameFragment containing a lacZ⍺ expression cassette flanked by BsaI sites
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)485
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer none (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameFragment containing an I-SceI recognition sequence
-
SpeciesSynthetic
-
Insert Size (bp)372
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypDOC-K received from Stephen Busby (University of Birmingham, UK)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDOC-GG was a gift from Mark Pallen (Addgene plasmid # 149377 ; http://n2t.net/addgene:149377 ; RRID:Addgene_149377) -
For your References section:
Creation of Golden Gate constructs for gene doctoring. Thomson NM, Zhang C, Trampari E, Pallen MJ. BMC Biotechnol. 2020 Oct 7;20(1):54. doi: 10.1186/s12896-020-00648-5. 10.1186/s12896-020-00648-5 PubMed 33028286