pDOC-GG
(Plasmid #149377)

• Purpose: Chassis plasmid for building mutagenesis cassettes by Golden Gate assembly to form a donor plasmid for recombineering by Gene Doctoring
• Depositing Lab: Mark Pallen
• Publication: Thomson et al BMC Biotechnol. 2020 Oct 7;20(1):54. doi: 10.1186/s12896-020-00648-5.

Backbone

• Vector backbone: pDOC-K
• Backbone size w/o insert (bp): 3378
• Total vector size (bp): 5960
• Modifications to backbone: Vector backbone fragment containing sacB gene generated by PCR with forward primer GGTAGTGTGGCGAGAGTAGGGAACTGCCAG and reverse primer CCAATTCTGACACATTTCCCCGAAAAGTGCC
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Fragment containing a kanamycin resistance cassette
• Alt name: kanR
• Alt name: aph(3')-Ia
• Alt name: neoR
• Species: Synthetic; E. coli
• Insert Size (bp): 968

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: none

Gene/Insert 2

• Gene/Insert name: Fragment containing pMB1 origin of replication and an I-SceI recognition sequence
• Species: Synthetic; E. coli
• Insert Size (bp): 933

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: none

Gene/Insert 3

• Gene/Insert name: Fragment containing a lacZ⍺ expression cassette flanked by BsaI sites
• Species: Synthetic; E. coli
• Insert Size (bp): 485

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: none

Gene/Insert 4

• Gene/Insert name: Fragment containing an I-SceI recognition sequence
• Species: Synthetic
• Insert Size (bp): 372

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: none

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pDOC-K received from Stephen Busby (University of Birmingham, UK)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry