Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDOC-GG
(Plasmid #149377)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149377 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDOC-K
  • Backbone size w/o insert (bp) 3378
  • Total vector size (bp) 5960
  • Modifications to backbone
    Vector backbone fragment containing sacB gene generated by PCR with forward primer GGTAGTGTGGCGAGAGTAGGGAACTGCCAG and reverse primer CCAATTCTGACACATTTCCCCGAAAAGTGCC
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Fragment containing a kanamycin resistance cassette
  • Alt name
    kanR
  • Alt name
    aph(3')-Ia
  • Alt name
    neoR
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    968

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Fragment containing pMB1 origin of replication and an I-SceI recognition sequence
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    933

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Fragment containing a lacZ⍺ expression cassette flanked by BsaI sites
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    485

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    Fragment containing an I-SceI recognition sequence
  • Species
    Synthetic
  • Insert Size (bp)
    372

Cloning Information for Gene/Insert 4

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pDOC-K received from Stephen Busby (University of Birmingham, UK)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDOC-GG was a gift from Mark Pallen (Addgene plasmid # 149377 ; http://n2t.net/addgene:149377 ; RRID:Addgene_149377)
  • For your References section:

    Creation of Golden Gate constructs for gene doctoring. Thomson NM, Zhang C, Trampari E, Pallen MJ. BMC Biotechnol. 2020 Oct 7;20(1):54. doi: 10.1186/s12896-020-00648-5. 10.1186/s12896-020-00648-5 PubMed 33028286