pLentiCas9-P2A-BFP
(Plasmid
#149447)
-
PurposeExpresses Cas9 and BFP in a lentiviral vector.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-Cas9
- Backbone size w/o insert (bp) 12364
- Total vector size (bp) 13177
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2A-BFP
-
Alt nameBlue Fluorescent Protein
-
Insert Size (bp)813
- Promoter In frame with Cas9
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGGACGCCACCCTGATCC
- 3′ sequencing primer TTAAAGCAGCGTATCCACATA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCas9-P2A-BFP was a gift from Jonathan Chernoff (Addgene plasmid # 149447 ; http://n2t.net/addgene:149447 ; RRID:Addgene_149447) -
For your References section:
A Facile Method to Engineer Mutant Kras Alleles in an Isogenic Cell Background. Budagyan K, Chernoff J. Methods Mol Biol. 2021;2262:323-334. doi: 10.1007/978-1-0716-1190-6_20. 10.1007/978-1-0716-1190-6_20 PubMed 33977487