Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCHA1.1-Rap2a-V5
(Plasmid #149509)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149509 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCHA1.1
  • Backbone size w/o insert (bp) 7994
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAP2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    549
  • Mutation
    Codon Optimized Sequence
  • Entrez Gene
    RAP2A (a.k.a. K-REV, KREV, RAP2, RbBP-30)
  • Promoter Ubc
  • Tag / Fusion Protein
    • V5 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ctgctgtccctgtaataaacccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCHA1.1-Rap2a-V5 was a gift from David Sabatini (Addgene plasmid # 149509 ; http://n2t.net/addgene:149509 ; RRID:Addgene_149509)
  • For your References section:

    MFSD12 mediates the import of cysteine into melanosomes and lysosomes. Adelmann CH, Traunbauer AK, Chen B, Condon KJ, Chan SH, Kunchok T, Lewis CA, Sabatini DM. Nature. 2020 Nov 18. pii: 10.1038/s41586-020-2937-x. doi: 10.1038/s41586-020-2937-x. 10.1038/s41586-020-2937-x PubMed 33208952