Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNos-PE2-attB
(Plasmid #149549)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149549 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    nos-Cas9
  • Backbone manufacturer
    Xingjie Ren, Norbert Perrimon, and Jian-Quan Ni
  • Modifications to backbone
    Digestion with XbaI/AvrII to remove Cas9 coding sequence
  • Vector type
    Insect Expression, CRISPR
  • Selectable markers
    vermillion+

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PE2
  • Alt name
    Prime editor 2
  • Species
    Synthetic
  • Insert Size (bp)
    6354
  • Promoter nanos (nos)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTAGTTGGCGCGTAGCTTT
  • 3′ sequencing primer GCACGGGATAACGCTCTAAA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    PE2 coding sequence PCR amplified from pCMV-PE2 (Addgene 132775). David Liu lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNos-PE2-attB was a gift from Norbert Perrimon (Addgene plasmid # 149549 ; http://n2t.net/addgene:149549 ; RRID:Addgene_149549)
  • For your References section:

    Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210