pAct-GW-HygroR
(Plasmid
#149610)
-
PurposeGateway compatible expression plasmid for Drosophila and establishing stable cell lines by Hygromycin selection. Actin5c ubiquitous promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMK33-Act5c
-
Modifications to backboneMT promoter from pMK33 replaced with Act5c promoter
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGateway cassette (ccdb + Chlor.R.)
- Promoter Act5c
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GAGCATTGCGGCTGATAAGG
- 3′ sequencing primer CCTCGACTTCTCCTCCTCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInvitrogen
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct-GW-HygroR was a gift from Norbert Perrimon (Addgene plasmid # 149610 ; http://n2t.net/addgene:149610 ; RRID:Addgene_149610) -
For your References section:
Precise genome engineering in Drosophila using prime editing. Bosch JA, Birchak G, Perrimon N. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1). pii: 2021996118. doi: 10.1073/pnas.2021996118. 10.1073/pnas.2021996118 PubMed 33443210