pBbdCas9S(RBSmut)_Psyn-sgRNArodA
(Plasmid
#149656)
-
Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBbdCas9S(RBSmut)
-
Backbone manufacturerCJW lab
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB 5-alpha F' Iq
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9, lacI, sgRNArodA
-
gRNA/shRNA sequenceTTAATCTACCTAATATACCA
-
SpeciesSynthetic
- Promoter PflaB, PpQE30, Psyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbdCas9S(RBSmut)_Psyn-sgRNArodA was a gift from Christine Jacobs-Wagner (Addgene plasmid # 149656 ; http://n2t.net/addgene:149656 ; RRID:Addgene_149656) -
For your References section:
A CRISPR interference platform for selective downregulation of gene expression in Borrelia burgdorferi. Takacs CN, Scott M, Chang Y, Kloos ZA, Irnov I, Rosa PA, Liu J, Jacobs-Wagner C. Appl Environ Microbiol. 2020 Nov 30. pii: AEM.02519-20. doi: 10.1128/AEM.02519-20. 10.1128/AEM.02519-20 PubMed 33257311