-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMKO.1
- Backbone size w/o insert (bp) 6700
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePP2A regulatory subunit A, alpha isoform
-
Alt namePP2A A alpha
-
SpeciesH. sapiens (human)
-
Insert Size (bp)58
-
Entrez GenePPP2R1A (a.k.a. HJS2, MRD36, PP2A-Aalpha, PP2AA, PP2AAALPHA, PR65A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLXSN 5'
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: GACAACAGCACCTTGCAGAGT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMKO.1-Puro-shPP2A-Aalpha was a gift from William Hahn (Addgene plasmid # 15249 ; http://n2t.net/addgene:15249 ; RRID:Addgene_15249) -
For your References section:
The tumor suppressor PP2A Abeta regulates the RalA GTPase. Sablina AA, Chen W, Arroyo JD, Corral L, Hector M, Bulmer SE, DeCaprio JA, Hahn WC. Cell. 2007 Jun 1. 129(5):969-82. 10.1016/j.cell.2007.03.047 PubMed 17540176