ACE2 g4 + Cas9
(Plasmid
#153014)
-
PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2
-
Depositing Lab
-
Depositing OrganizationCold Spring Harbor Laboratory
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153014 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLenti-Cas9-gRNA-TagBFP2 (Addgene #124774)
-
Modifications to backbonegRNA sequence: TGGATACATTTGGGCAAGTG
-
Vector typeLentiviral
-
Selectable markersTagBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9 + ACE2 gRNA
-
gRNA/shRNA sequenceTGGATACATTTGGGCAAGTG
-
SpeciesH. sapiens (human)
-
Entrez GeneACE2 (a.k.a. ACEH)
-
Tag
/ Fusion Protein
- TagBFP2
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACE2 g4 + Cas9 was a gift from Jason Sheltzer (Addgene plasmid # 153014 ; http://n2t.net/addgene:153014 ; RRID:Addgene_153014)