Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ACE2 g1 + Cas9
(Plasmid #153011)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153011 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Lentiviral Prep 153011-LV Back-ordered
Virus (1mL at titer ≥ 5x10⁵ TU/mL) and Plasmid.
$130

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Lenti-Cas9-gRNA-TagBFP2 (Addgene #124774)
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    TagBFP2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 + ACE2 gRNA
  • Alt name
    ACE2
  • gRNA/shRNA sequence
    ACCTGGGGAAGGGCGACTTC
  • Species
    H. sapiens (human)
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Tag / Fusion Protein
    • TagBFP2

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for Lentiviral Prep (Catalog # 153011-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from ACE2 g1 + Cas9 (#153011). In addition to the viral particles, you will also receive purified ACE2 g1 + Cas9 plasmid DNA.

Lentiviral particles carrying a guide RNA targeting ACE2 and co-expressing Cas9 and TagBFP2.

Delivery

  • Volume 1mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $100 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer OptiPro

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Titering Method:
  • ddPCR assay: 293T cells were transduced with serial dilutions of 153011-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
Notes:
  • PCR confirmation of insert: PCRs were carried out on the viral preparation with primers targeting the Cas9 and TagBFP genes to confirm inserts and primers targeting the EF1a promoter and the ACE2 guide to confirm the backbone and guide sequences. The PCR products were visualized on an agarose gel for size confirmation.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACE2 g1 + Cas9 was a gift from Jason Sheltzer (Addgene plasmid # 153011 ; http://n2t.net/addgene:153011 ; RRID:Addgene_153011)

    For viral preps, please replace (Addgene plasmid # 153011) in the above sentence with: (Addgene viral prep # 153011-LV)