Skip to main content
Addgene

pLVX-EF1α-BHLHE40 aa1-297-IRES-ZsGreen1
(Plasmid #153062)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153062 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLVX-EF1α-IRES-ZsGreen1
  • Backbone size w/o insert (bp) 8871
  • Total vector size (bp) 10116
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Truncated form of human BHLHE40 (aa 1-297)
  • Species
    H. sapiens (human)
  • Mutation
    Mutagenesis to insert a stop codon at aa 298 in BHLHE40 in order to express a truncated form. 7 base pairs after the new stop codon a new XbaI restriction site was inserted by mutagenesis.
  • Entrez Gene
    BHLHE40 (a.k.a. BHLHB2, Clast5, DEC1, HLHB2, SHARP-2, SHARP2, STRA13, Stra14)
  • Promoter EF1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTCCATTTCAGGTGTCGTGA
  • 3′ sequencing primer ACACCGGCCTTATTCCAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-EF1α-BHLHE40 aa1-297-IRES-ZsGreen1 was a gift from Silvia Monticelli (Addgene plasmid # 153062 ; http://n2t.net/addgene:153062 ; RRID:Addgene_153062)
  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878