Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX-EF1α-BHLHE40-IRES-ZsGreen1
(Plasmid #153061)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153061 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX-EF1α-IRES-ZsGreen1
  • Backbone size w/o insert (bp) 8871
  • Total vector size (bp) 10116
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BHLHE40
  • Alt name
    Dec1
  • Alt name
    Stra13
  • Alt name
    Sharp2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1245
  • Entrez Gene
    BHLHE40 (a.k.a. BHLHB2, Clast5, DEC1, HLHB2, SHARP-2, SHARP2, STRA13, Stra14)
  • Promoter EF1α

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTCCATTTCAGGTGTCGTGA
  • 3′ sequencing primer ACACCGGCCTTATTCCAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-EF1α-BHLHE40-IRES-ZsGreen1 was a gift from Silvia Monticelli (Addgene plasmid # 153061 ; http://n2t.net/addgene:153061 ; RRID:Addgene_153061)
  • For your References section:

    A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878