Auxiliary B
(Plasmid
#153353)
-
PurposeProvides End-to-End linker 4B for level 2 cloning
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153353 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAux
- Backbone size w/o insert (bp) 2217
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEnd-to-End linker 4B
-
SpeciesSynthetic
-
Insert Size (bp)50
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Auxiliary B was a gift from Naomi Nakayama (Addgene plasmid # 153353 ; http://n2t.net/addgene:153353 ; RRID:Addgene_153353) -
For your References section:
Mobius Assembly for Plant Systems highlights promoter-terminator interaction in gene regulation. Andreou , Andreas I., Nirkko, Jessica , Ochoa-Villarreal, Marisol , Nakayama, Naomi. bioRxiv, March 31, 2021 10.1101/2021.03.31.437819