lvl0 G10-90p
(Plasmid
#153370)
-
PurposeSynthetic promoter for plant expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153370 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemUAV
- Backbone size w/o insert (bp) 2053
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG10-90 promoter
-
SpeciesSynthetic
-
Insert Size (bp)239
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AarI (destroyed during cloning)
- 3′ cloning site AarI (destroyed during cloning)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note there is one ambiguous base in the CaMV 35S promoter. This base pair is a mixed population of an A and T. Depositor confirms this mixed population does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lvl0 G10-90p was a gift from Naomi Nakayama (Addgene plasmid # 153370 ; http://n2t.net/addgene:153370 ; RRID:Addgene_153370) -
For your References section:
Mobius Assembly for Plant Systems highlights promoter-terminator interaction in gene regulation. Andreou , Andreas I., Nirkko, Jessica , Ochoa-Villarreal, Marisol , Nakayama, Naomi. bioRxiv, March 31, 2021 10.1101/2021.03.31.437819